What is STR analysis in DNA fingerprinting?
STR analysis is a tool in forensic analysis that evaluates specific STR regions found on nuclear DNA. The variable (polymorphic) nature of the STR regions that are analyzed for forensic testing intensifies the discrimination between one DNA profile and another.
How is STR used in fingerprinting?
STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which is one of the main STR markers used for DNA fingerprinting. STRs occur throughout the genome.
What is a DNA STR?
STRs are short sequences of DNA, normally of length 2-5 base pairs, that are repeated numerous times in a head-tail manner, i.e. the 16 bp sequence of “gatagatagatagata” would represent 4 head-tail copies of the tetramer “gata”.
How are STR used in forensic analysis?
STR typing involves the general steps for DNA profiling in the following order: isolation of DNA by a process called DNA extraction, quantification of the DNA in the sample, amplification of STR loci, separation of the PCR amplicons on a genetic analyser using bioinformatics to analyse the resulting data and comparing …
What are the advantages of STR fingerprinting?
What are advantages of STR fingerprinting over VNTR fingerprinting? It is more accurate and small and partially degraded samples can be analyzed. What is the significance of non-coding DNA to DNA identification? Non-coding DNA does not code for proteins and shows the variations in DNA between individuals.
How are STRs used to create a DNA profile?
Chemicals are added to break open the cells, extract the DNA and isolate it from other cell components. Often only small amounts of DNA are available for forensic analysis so the STRs at each genetic locus are copied many times using the polymerase chain reaction (PCR) to get enough DNA to make a profile.
What is advantage of STR analysis?
The main advantage of the Y-STR approach is the ability to detect the male component even in extreme mixtures of male and female DNA. It is also useful for rapid screening of large number of stains and the determination of the number of semen donors for mixtures of two or more male individuals.